View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5798-23 (Length: 84)
Name: Solexa-NF5798-23
Description: NF5798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5798-23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 42914018 - 42914105
Alignment:
| Q |
1 |
caaaattcgattgttgtttattagacaaggttgagt-aaacaaaagtgaacaatgaactta----aaacgcattgtttagtagaacct |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42914018 |
caaaattcgattgttgtttattagacaaggctgagtaaaacaaaagtgaacaatgaacttaagttaaacgcattgtttagtagaacct |
42914105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University