View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5798-6 (Length: 139)
Name: Solexa-NF5798-6
Description: NF5798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5798-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 4e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 4e-42
Query Start/End: Original strand, 25 - 139
Target Start/End: Original strand, 48520760 - 48520873
Alignment:
| Q |
25 |
ttagtaacccactggattgtattaatagataagatacttatttttggttcgtctttggtagaatcaggaccctttgnttmtyytcwttttttrgtgggtt |
124 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || | | |||||| ||||||| |
|
|
| T |
48520760 |
ttagtaacccactagattgtattaatagataagatacttatttttggttcgtctttggtagaatcagtaccctttg-ttatttttattttttagtgggtt |
48520858 |
T |
|
| Q |
125 |
taatactcattgtac |
139 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48520859 |
taatactcattgtac |
48520873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University