View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5798-9 (Length: 135)
Name: Solexa-NF5798-9
Description: NF5798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5798-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 20543911 - 20543865
Alignment:
| Q |
89 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20543911 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
20543865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 4267789 - 4267743
Alignment:
| Q |
89 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4267789 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
4267743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 21910553 - 21910507
Alignment:
| Q |
89 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21910553 |
gttcaagctatcatttttaaaacttaatcctttgtaaaagttatgat |
21910507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University