View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5799-10 (Length: 135)
Name: Solexa-NF5799-10
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5799-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 36982948 - 36982824
Alignment:
| Q |
11 |
gtagcatgaactcttcagattgaagatgtgtcatgtgtctgacatcgacatgaatctgacacatgtatttatttcatcagttctattttctaaaattagg |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36982948 |
gtagcatgcactcttcagattgaagatgtgtcgtgtgtctgacatcgacatgaatctgacacatgtatttatttcatcagttctattttctaaaattagg |
36982849 |
T |
|
| Q |
111 |
ac-tgatgtctatgtgctagtgtcg |
134 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
36982848 |
acatgatgtctatgtgctagtgtcg |
36982824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University