View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5799-18 (Length: 118)
Name: Solexa-NF5799-18
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5799-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 40151201 - 40151082
Alignment:
| Q |
1 |
aacacattggagcctagggaagagttttctacacaacagcatggtgaagctgt--aacacgttatttatgttgtttaagatataggataacatttataaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40151201 |
aacacattggagcctagggaagagttttctacacaacagcatggtgaagctgtgtaacacgttatttatgttgtttaagatataagataacatttataaa |
40151102 |
T |
|
| Q |
99 |
tagtaacaaggatttatcac |
118 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40151101 |
tagtaacaaggatttatcac |
40151082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University