View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5799-20 (Length: 101)
Name: Solexa-NF5799-20
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5799-20 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 5e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 36982517 - 36982617
Alignment:
| Q |
1 |
aatactgaagagtattgttgtagagggagttatgaaaaccctgccacacgtttgccttcaaactactctaacatttttcaacaagtttgtcctgcagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36982517 |
aatactgaagagtattgttgtagagggagttatgaaaaccctgctacctgtttgccttcaaactactctaacatttttaaacaagtttgtcctgcagcat |
36982616 |
T |
|
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
36982617 |
a |
36982617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 42
Target Start/End: Original strand, 36963601 - 36963640
Alignment:
| Q |
3 |
tactgaagagtattgttgtagagggagttatgaaaaccct |
42 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
36963601 |
tactgatgaatattgttgcagagggagttatgaaaaccct |
36963640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University