View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5799-22 (Length: 62)
Name: Solexa-NF5799-22
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5799-22 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 5e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 22263934 - 22263988
Alignment:
| Q |
8 |
tttcaatcattgcagggtcattgctgaaatttctgagcttaacttgattctatgc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22263934 |
tttcaatcattgcagggtcattgctgaaatttctgagcttaacttgattccatgc |
22263988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 5e-21
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 22269906 - 22269852
Alignment:
| Q |
8 |
tttcaatcattgcagggtcattgctgaaatttctgagcttaacttgattctatgc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22269906 |
tttcaatcattgcagggtcattgctgaaatttctgagcttaacttgattccatgc |
22269852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 10083138 - 10083185
Alignment:
| Q |
10 |
tcaatcattgcagggtcattgctgaaatttctgagcttaacttgattc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
10083138 |
tcaatcattgcagggtcattgctgaaattccgaagcttaacttgattc |
10083185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University