View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5799-27 (Length: 38)
Name: Solexa-NF5799-27
Description: NF5799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5799-27 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 33; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 13879741 - 13879777
Alignment:
| Q |
2 |
aggagatggcaaccagagacatggcggcaggagcgaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13879741 |
aggagatggcaaccagagacatggcggcagtagcgaa |
13879777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University