View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5800-1 (Length: 136)
Name: Solexa-NF5800-1
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5800-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 2e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 28567504 - 28567369
Alignment:
| Q |
1 |
acaagggaggtccatgagataacatctttctcaagcatcttttcaaacactgtgtatgcacaatccatgtccccagttttggcatacatgtcaacaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28567504 |
acaagggaggtccatgagataacatctttctcaagcatcttttcaaacactgtgtatgcacaatccatgtccccagttttggcatacatgtcaacaagag |
28567405 |
T |
|
| Q |
101 |
cattgctaacaagcttataattctcaaatccagttt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28567404 |
cattgctaacaagcttataattctcaaatccagttt |
28567369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University