View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5800-10 (Length: 94)
Name: Solexa-NF5800-10
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5800-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 47282130 - 47282180
Alignment:
| Q |
1 |
cgaggacattttaaccaactgaggaggtttgtggaaagagatgaaggaaag |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| || |||||||| |
|
|
| T |
47282130 |
cgaggacattttaaccaactgaggaggtttgtgggaagacattaaggaaag |
47282180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University