View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5800-9 (Length: 100)
Name: Solexa-NF5800-9
Description: NF5800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5800-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 3e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 4703838 - 4703747
Alignment:
| Q |
1 |
aagggtgtgtcgtacgtagttcatgttgtgaccttggagttatatacacgcacgggatatgtttggggtggaggcgtaagagcaattgggtcatgttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4703838 |
aagggtgtgtcgtacgtagttcatgttgtgaccttggagttatatacacgcacgggatatgtt--------gggcgtaagagcaattgggtcatgttgtt |
4703747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University