View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-10 (Length: 138)
Name: Solexa-NF5801-10
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 5995850 - 5995713
Alignment:
| Q |
1 |
gagaatatggtgacaataaagttggaatgtgtgctcctttccatggttaatcacaaagttggacaatatgatgtatttttattttaaatcataatatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995850 |
gagaatatggtgacaataaagttggaatgtgtgctcctttccatggttaatcacaaggttggacaatatgatgtatttttattttaaatcataatatgat |
5995751 |
T |
|
| Q |
101 |
gtaaatttgcaattgcctaagctgatagagacaaattt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995750 |
gtaaatttgcaattgcctaagctgatagagacaaattt |
5995713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University