View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-11 (Length: 138)
Name: Solexa-NF5801-11
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 9 - 138
Target Start/End: Complemental strand, 28191547 - 28191418
Alignment:
| Q |
9 |
ccaattgagattccaaattagaattacggacaacattgcccaaaaataccttaattagctcaaagttttctttgtcgatgatagagataacctgctgcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28191547 |
ccaattgagattccaaattagaattacggacaacattgctcaaaaataccttaattagctcaaagttttctttgtcgatgatagagataacctgttgcca |
28191448 |
T |
 |
| Q |
109 |
aatatttgctgtctatgttctatgcactta |
138 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
28191447 |
aatatttgttgtctatgttctatgcactta |
28191418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University