View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-15 (Length: 130)
Name: Solexa-NF5801-15
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 45461570 - 45461690
Alignment:
| Q |
8 |
ggaaaaacttaggtggccgtatatgctgctggctgaaaatatgttgttaattaaatttccgaaaggtataaacaatttgtcatgtaatatattaattaac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45461570 |
ggaaaaacttaggtggccgtatatgctgctggctgaaaataggttgttaattaaatttccgaaaggtataaacaatttgtcatgta--atattaattaac |
45461667 |
T |
 |
| Q |
108 |
cgaaagcaaatattgacactgat |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45461668 |
cgaaagcaaatattgacactgat |
45461690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University