View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-19 (Length: 127)
Name: Solexa-NF5801-19
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 6 - 116
Target Start/End: Original strand, 38680548 - 38680659
Alignment:
| Q |
6 |
caatttgcacaaatcttgtttgtattgagagaatcccttttttaaaataagtaaataaataacgttttagagaactaaaatgaacattaatctggtatg- |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38680548 |
caatttgcacaaatcttgtttgtattgagagaatcccttttttaaaataagtaaataaataacattttagagaactaaaatgaacattaatctggtatgt |
38680647 |
T |
 |
| Q |
105 |
aaaaaggtttac |
116 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38680648 |
aaaaaggtttac |
38680659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University