View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-21 (Length: 113)
Name: Solexa-NF5801-21
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 8e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 44167248 - 44167358
Alignment:
| Q |
2 |
aattgtaaatgcaaattggattacggctaacacaaaatttcccacttcattctctnnnnnnnnnntcttcccacttcatgacttatatatatttgcctag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44167248 |
aattgtaaatgcaaattggattacggctaacacaaaatttcccacttcattctct-aaaaaaaaatcttcccacttcatgacttatatatattttcctag |
44167346 |
T |
 |
| Q |
102 |
tatcacatagtc |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44167347 |
tatcacatagtc |
44167358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University