View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-4 (Length: 220)
Name: Solexa-NF5801-4
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-4 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0200 (Bit Score: 161; Significance: 3e-86; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 161; E-Value: 3e-86
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 29933 - 29715
Alignment:
| Q |
11 |
ttaaggtagttaagaacaaaattaaatatttwgtttaaatttgacaattatgattgatcaataatataaacttttctttatattgacgattcatatgaac |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29933 |
ttaaggcagttaagaacaaaattaaatattttatttaaatttaacaattatgattgatcaataatataaacttttctttatattgacgattcatatgaac |
29834 |
T |
|
| Q |
111 |
aaagaccgtgtttggatatata---------tacttaaagttcttatagcatataagtgcttatgtatacggctataagttgttttcgtaaaatctccca |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
29833 |
aaagaccgtgtttggatatatatatataacctacttatagttcttatagcatataagtgcttatgtatacggctacaagttgttttcgtaaactctccca |
29734 |
T |
|
| Q |
202 |
aatagtctcacaagtcttc |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29733 |
aatagtctcacaagtcttc |
29715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 216
Target Start/End: Original strand, 8094376 - 8094416
Alignment:
| Q |
176 |
ataagttgttttcgtaaaatctcccaaatagtctcacaagt |
216 |
Q |
| |
|
||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
8094376 |
ataagctgttttcataaaatctctcaaatagtctcacaagt |
8094416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University