View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-5 (Length: 219)
Name: Solexa-NF5801-5
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 45462066 - 45461848
Alignment:
| Q |
1 |
gaaaatcagagtagcggcactggcctggtcaaagagagtagtggagtagcataggcaagggcatggaaagaacaagaaaaggaagaagaagacagtagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462066 |
gaaaatcagagtagcggcactggcctggtcaaagagaatagtgttgccacataggcaagggcatggaaagaacaagaaaaggaagaagaagacagtagta |
45461967 |
T |
|
| Q |
101 |
ctatgtgaaggagttgttaaagacaagaacaaaatcatgcatatttggcaaactatgattttccctgtcaggcgtctatgtcttgctctctctacccgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461966 |
ctatgtgaaggagttgttaaagacaagaacaaaatcatgcatatttggcaaactatgattttccctgtcaggcgtctatgtcttgctctctctacccgta |
45461867 |
T |
|
| Q |
201 |
tcaaccacatcaaaaacgg |
219 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
45461866 |
tcaaccaccgcaaaaacgg |
45461848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University