View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5801-8 (Length: 152)
Name: Solexa-NF5801-8
Description: NF5801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5801-8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 2e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 40058736 - 40058839
Alignment:
| Q |
8 |
ccttgacccaacaaaactcgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacatcgagaatcaataacc |
107 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40058736 |
ccttgacccaacaaaacttgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacaacgagaatcaataacc |
40058835 |
T |
 |
| Q |
108 |
catt |
111 |
Q |
| |
|
|||| |
|
|
| T |
40058836 |
catt |
40058839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 96 - 152
Target Start/End: Original strand, 40059056 - 40059112
Alignment:
| Q |
96 |
gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaagat |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40059056 |
gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaagat |
40059112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University