View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5802-3 (Length: 180)
Name: Solexa-NF5802-3
Description: NF5802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5802-3 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 6e-62; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 6e-62
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 37704459 - 37704338
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtscttttttattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37704459 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaaatgcggtccttttttattc |
37704360 |
T |
|
| Q |
108 |
tattgccttattttacttttca |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37704359 |
tattgccttattttacttttca |
37704338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 9e-34
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 37437525 - 37437445
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatcctaaatcatcaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37437525 |
tttggtccttgccccttagtttcaagttatgtttcctatataaatagaggctaatcatttggtatatcctaaatcatcaaa |
37437445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 9e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 37698641 - 37698571
Alignment:
| Q |
8 |
tttggtccttgccccttagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta |
78 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37698641 |
tttggtcctttccccgtagtttcaggttatgtttcctatataaatagaggctaatcaattggtatatccta |
37698571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 87 - 121
Target Start/End: Complemental strand, 37698505 - 37698471
Alignment:
| Q |
87 |
aaatgcggtscttttttattctattgccttatttt |
121 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37698505 |
aaatggggtccttttttattctattgccttatttt |
37698471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 9e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 9e-25
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 16299645 - 16299702
Alignment:
| Q |
123 |
cttttcaatgttcacagtgcttgttgcacttctttctcaataccttgtgattcctgtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16299645 |
cttttcaatgttcacagtgcttgttgcacttctttctcaataccttgtgattcctgtg |
16299702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 129
Target Start/End: Complemental strand, 14554758 - 14554726
Alignment:
| Q |
97 |
cttttttattctattgccttattttacttttca |
129 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
14554758 |
cttttttattctattgccttattttacctttca |
14554726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 8e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 22 - 88
Target Start/End: Original strand, 16841203 - 16841272
Alignment:
| Q |
22 |
cttagtttcaggttatgtttcctatataaata---gaggctaatcaattggtatatcctaaatcatcaaa |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
16841203 |
cttagtttcaggttatgtttcctatataaatagaggaggctaatcagttggtatatcgtaaatcatcaaa |
16841272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University