View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5802-5 (Length: 160)
Name: Solexa-NF5802-5
Description: NF5802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5802-5 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] scaffold0416 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 5e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 44377891 - 44377734
Alignment:
| Q |
3 |
gacacaagagaagaaactcaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377891 |
gacacaagagaagaaacccaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
44377792 |
T |
|
| Q |
103 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagccttgc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44377791 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagccttgc |
44377734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 44393471 - 44393314
Alignment:
| Q |
3 |
gacacaagagaagaaactcaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393471 |
gacacaagagaagaaacccaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
44393372 |
T |
|
| Q |
103 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagccttgc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393371 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagccttgc |
44393314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0416 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: scaffold0416
Description:
Target: scaffold0416; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 3 - 160
Target Start/End: Complemental strand, 12498 - 12341
Alignment:
| Q |
3 |
gacacaagagaagaaactcaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
102 |
Q |
| |
|
||||||||||||||| | || ||| |||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||| || |
|
|
| T |
12498 |
gacacaagagaagaaccccagcgccttgccattcaccaaaatagaaagtctggccgagtgtaaaattgccaaaatccaattggagaaaacagaagaaaaa |
12399 |
T |
|
| Q |
103 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagccttgc |
160 |
Q |
| |
|
|| ||||| ||||||||||||| |||||||||||| |||||||| | ||||||||||| |
|
|
| T |
12398 |
ccaaactgatgcaacaccgcaattaagaaattccagtccagcgtatcaaaagccttgc |
12341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 7e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 3 - 158
Target Start/End: Original strand, 31554785 - 31554940
Alignment:
| Q |
3 |
gacacaagagaagaaactcaccgctttgccattcaccaaaatagagagtcttgccgagtgtaaaatcgccaaaatccaattggagaagacagaagagaac |
102 |
Q |
| |
|
||||||||| ||||| | ||| |||||||||| ||||||||||| ||||| ||||||||||||| || |||||||||||||| || ||||| || || |
|
|
| T |
31554785 |
gacacaagaaaagaatcccacaactttgccatttaccaaaatagatagtctggccgagtgtaaaaccggcaaaatccaattgggaaaaacagatgaaaaa |
31554884 |
T |
|
| Q |
103 |
ccgaactgttgcaacaccgcaagtaagaaattccaatccagcgtgttaaaagcctt |
158 |
Q |
| |
|
|| |||||||| |||||||||| ||| |||||| | |||||||| | ||||||||| |
|
|
| T |
31554885 |
ccaaactgttgtaacaccgcaattaaaaaattctagtccagcgtatcaaaagcctt |
31554940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 20852527 - 20852483
Alignment:
| Q |
6 |
acaagagaagaaactcaccgctttgccattcaccaaaatagagag |
50 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
20852527 |
acaagagaagtaacccacgactttgccattcaccaaaatagagag |
20852483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 12161198 - 12161154
Alignment:
| Q |
6 |
acaagagaagaaactcaccgctttgccattcaccaaaatagagag |
50 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
12161198 |
acaagagaaaaaacccaccgcttttgcattcaccaaaatagagag |
12161154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Complemental strand, 15157209 - 15157165
Alignment:
| Q |
6 |
acaagagaagaaactcaccgctttgccattcaccaaaatagagag |
50 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
15157209 |
acaagagaaaaaacccaccgcttttgcattcaccaaaatagagag |
15157165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University