View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5803-3 (Length: 135)
Name: Solexa-NF5803-3
Description: NF5803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5803-3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 13 - 135
Target Start/End: Original strand, 70044 - 70166
Alignment:
| Q |
13 |
tactgtactgtactgtgtttttgcaggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaaggacaagaaatcaccat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
70044 |
tactgtactgtactgtgtttttgcaggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaaggacaagaaatcaccat |
70143 |
T |
|
| Q |
113 |
aactactgattatgaaatcaagg |
135 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
70144 |
aactactgattatgaaatcaagg |
70166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 37 - 97
Target Start/End: Complemental strand, 40597530 - 40597470
Alignment:
| Q |
37 |
aggggcctgagattcggactggctttctcaaagatggaaaacctattcaactcaaagaagg |
97 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||| |||||||| ||||| ||| |||| |
|
|
| T |
40597530 |
aggggcctgagattcgtactggatttctcaaggatggcaaacctatccaactgaaacaagg |
40597470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University