View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5803-8 (Length: 80)
Name: Solexa-NF5803-8
Description: NF5803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5803-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 40147264 - 40147323
Alignment:
| Q |
8 |
acaatgaaagcgggagagttgttggaagatggtgggcttggtaaaggtgcgtgggggata |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40147264 |
acaatgaaagcgggagagttgttggaagatggtgggcttggtaaaggtgcttgggcgata |
40147323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 62
Target Start/End: Complemental strand, 6500703 - 6500652
Alignment:
| Q |
11 |
atgaaagcgggagagttgttggaagatggtgggcttggtaaaggtgcgtggg |
62 |
Q |
| |
|
|||||||| || |||||||||||||| || ||| ||||||||||||| |||| |
|
|
| T |
6500703 |
atgaaagctggtgagttgttggaagaaggcgggattggtaaaggtgcttggg |
6500652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University