View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-14 (Length: 127)
Name: Solexa-NF5804-14
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 8940067 - 8940187
Alignment:
| Q |
7 |
attcagaactagatgtcattcaggaattagactagattattgaaacttgaatgttgtaagaagacacaatgccaaaaattagagtaaagaaataatggcc |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8940067 |
attcagaactagatgttattcaggaattagactagattattgaaacttgaatgttgtaagaagacacaatcccaaaaattagagtaaagaaataatggcc |
8940166 |
T |
|
| Q |
107 |
aactcagtatacatactgtta |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8940167 |
aactcagtatacatactgtta |
8940187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 11 - 46
Target Start/End: Original strand, 8927648 - 8927683
Alignment:
| Q |
11 |
agaactagatgtcattcaggaattagactagattat |
46 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8927648 |
agaactagatgtcattcaagaattagactagattat |
8927683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University