View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-15 (Length: 121)
Name: Solexa-NF5804-15
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 7e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 23687947 - 23688067
Alignment:
| Q |
1 |
aacaaaggggtttggagtggtggagataggcggttgtgggagggctgagtagtttaggttggagagtatgccaatccaattcgaaggaatacaaatgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
23687947 |
aacaaaggggtttggagtggtggagataggcggttgtgggagggctgagtagtttaggttggagagtgtgccaattcaattcgaaggaataaaaatgtat |
23688046 |
T |
 |
| Q |
101 |
tcttttgacgctagatccatg |
121 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
23688047 |
tcttttgacgccagatccatg |
23688067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 24060184 - 24060304
Alignment:
| Q |
1 |
aacaaaggggtttggagtggtggagataggcggttgtgggagggctgagtagtttaggttggagagtatgccaatccaattcgaaggaatacaaatgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
24060184 |
aacaaaggggtttggagtggtggagataggcggttgtgggagggctgagtagtttaggttggagagtgtgccaattcaattcgaaggaataaaaatgtat |
24060283 |
T |
 |
| Q |
101 |
tcttttgacgctagatccatg |
121 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
24060284 |
tcttttgacgccagatccatg |
24060304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University