View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-16 (Length: 120)
Name: Solexa-NF5804-16
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 32409094 - 32409207
Alignment:
| Q |
7 |
aggacattgttttgttgtaatgatttatgagcacacatgggaatagaggtaggtacctgatgctgatttgtccttgtggaaagttgagaatactagaagc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32409094 |
aggacattgttttgttgtaatgatttatgagcacacatgtgaatagaggtaggtacctgatgctgatttgtccttgtggaaagttgagaatactagaagc |
32409193 |
T |
|
| Q |
107 |
cacaagaaataata |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32409194 |
cacaagaaataata |
32409207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 7 - 62
Target Start/End: Complemental strand, 36163253 - 36163198
Alignment:
| Q |
7 |
aggacattgttttgttgtaatgatttatgagcacacatgggaatagaggtaggtac |
62 |
Q |
| |
|
|||| ||||||||||||| |||||| ||| ||||||||| ||||| |||| ||||| |
|
|
| T |
36163253 |
aggatattgttttgttgtgatgattaatgggcacacatgtgaatataggtgggtac |
36163198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University