View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-2 (Length: 222)
Name: Solexa-NF5804-2
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 15751669 - 15751459
Alignment:
| Q |
3 |
atacattaacgacataaaatttggtattaatcaagtaatgaaggttactgaagtaagaaaaagtaagaaagacgtcgagtgagatgaagaaagagggaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | | ||||| | | ||||||||||||| |
|
|
| T |
15751669 |
atacattaacgacataaaatttggtattaatcaagtaatgaaggttactgaagtaagaaa------gaaat-cat--agtgacaaggagaaagagggaaa |
15751579 |
T |
|
| Q |
103 |
tgatatcacaaaaccttatgagttgctcttgtctcaagccactgagcaatagagaacagaaagatgatgactccaccatctgtaaaatcttgtaaagcag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15751578 |
tgatatcacaaaaccttatgagttgctcttgtctcaagccactgagcaatagagaacagaaagatgatgactccaccatctgtaaaatcttgtaaagcag |
15751479 |
T |
|
| Q |
203 |
cagtaccccatactgcaaca |
222 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
15751478 |
cagtaccacatactgcaaca |
15751459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University