View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-20 (Length: 85)
Name: Solexa-NF5804-20
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 15344193 - 15344121
Alignment:
| Q |
2 |
cttctgaatgaacccatgcaggaggcccttacggcaccacatcactggacatgacaacatagacatgatctct |
74 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15344193 |
cttccgaatgaacccatgcaggaggcccttacggcaccacaccactggacatgacaacatagacatgatctct |
15344121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University