View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-23 (Length: 53)
Name: Solexa-NF5804-23
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 9e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 9e-16
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 17448040 - 17448085
Alignment:
| Q |
8 |
gtttcgattactgcaacgcttatagaggttccatgacactcacttt |
53 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17448040 |
gtttcgattattgcaacgcttatagaggttccatgacactcacttt |
17448085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 33278872 - 33278839
Alignment:
| Q |
8 |
gtttcgattactgcaacgcttatagaggttccat |
41 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
33278872 |
gtttcgattaatgcaacgcttatagaggttccat |
33278839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University