View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5804-3 (Length: 207)
Name: Solexa-NF5804-3
Description: NF5804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5804-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 37704564 - 37704770
Alignment:
| Q |
1 |
atcaaacttatccgaaccatgtatgtaaactacacaaatccctctacagtctcaagcaagccccgcgtgcatggtacaatgcactycactccttcgttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
37704564 |
atcaaacttatccgaaccatgtatgtaaactacacaaatccctctacggtctcaagcaagccccgcgtgcatggtacaatgcacttcactccttcgttct |
37704663 |
T |
|
| Q |
101 |
ggaatttggtttttcaaaatctcaaactgatccctctcttttcatctataaacaaggaaatattgtggcatactttctggtatatgttgatgatctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37704664 |
ggaatttggtttttcaaaatctcaaattgatccctctcttttcatctataaacaaggaaatattgtggcatactttctggtatatgttgatgatctttta |
37704763 |
T |
|
| Q |
201 |
cttacag |
207 |
Q |
| |
|
||||||| |
|
|
| T |
37704764 |
cttacag |
37704770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 21380419 - 21380495
Alignment:
| Q |
9 |
tatccgaaccatgtatgtaaactacacaaatccctctacagtctcaagcaagccccgcgtgcatggtacaatgcact |
85 |
Q |
| |
|
||||| || ||||| |||||||||| ||||| ||||||||||||| |||| | ||| ||||||||||||||||||| |
|
|
| T |
21380419 |
tatccaaatcatgtgtgtaaactaccgaaatctctctacagtctcatgcaatctccgtgtgcatggtacaatgcact |
21380495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 31924098 - 31924161
Alignment:
| Q |
18 |
catgtatgtaaactacacaaatccctctacagtctcaagcaagccccgcgtgcatggtacaatg |
81 |
Q |
| |
|
|||||||||||||| |||||||| || || |||| || || || ||||||||||||||||||| |
|
|
| T |
31924098 |
catgtatgtaaactccacaaatctctttatggtctaaaacaggctccgcgtgcatggtacaatg |
31924161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 25449461 - 25449524
Alignment:
| Q |
18 |
catgtatgtaaactacacaaatccctctacagtctcaagcaagccccgcgtgcatggtacaatg |
81 |
Q |
| |
|
|||||||||||||| |||||||| || || |||| || || || ||||||||||||||||||| |
|
|
| T |
25449461 |
catgtatgtaaactccacaaatctctttatggtctaaaacaggctccgcgtgcatggtacaatg |
25449524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University