View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-10 (Length: 114)
Name: Solexa-NF5806-10
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-10 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 1e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 43224069 - 43223956
Alignment:
| Q |
1 |
gagtgttttggttttcaaccatatattatcttggattttatattaggatactgtttcatctatatttcattgatgannnnnnnnggttaaccttaggaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43224069 |
gagtgttttggttttcaaccatatattatcttggattttttattaggatactgtttcatctatatttcattgatgattttttttggttaaccttaggaat |
43223970 |
T |
|
| Q |
101 |
tggtggagtgggag |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43223969 |
tggtggagtgggag |
43223956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 41654905 - 41655020
Alignment:
| Q |
1 |
gagtgttttggttttcaaccatatattatcttggattttatattaggata--ctgtttcatctatatttcattgatg-annnnnnnnggttaaccttagg |
97 |
Q |
| |
|
||||||||||||||| ||| ||||||| || | |||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
41654905 |
gagtgttttggttttaaac-atatattgtcatatattttatattaggatatactgtttcatctatatttcattgatgaattttttttggttaaccttagg |
41655003 |
T |
|
| Q |
98 |
aattggtggagtgggag |
114 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41655004 |
aattggtggagtgggag |
41655020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University