View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-11 (Length: 111)
Name: Solexa-NF5806-11
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 24829346 - 24829455
Alignment:
| Q |
1 |
tattcaacagatgcaattgctaggagagataaagcatgaaaatgtagctgaaattatctccnnnnnnnattcagaagatcaaaagcttgccatatatgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
24829346 |
tattcaacagatgcaattgctaggagagataaagcatgaaaatgtagctgaaattatctccttttttcattcagaagatcaaaagcttgtcatatatgaa |
24829445 |
T |
|
| Q |
101 |
cttgtctctg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
24829446 |
cttgtctctg |
24829455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University