View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-14 (Length: 95)
Name: Solexa-NF5806-14
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-14 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 4e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 8110341 - 8110247
Alignment:
| Q |
1 |
gacacaattaatccttgaactttttgatagtaagtcttgcaaagtttagctcgagttttagtaagactaaattcatggattattaataaaaattg |
95 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
8110341 |
gacacacttaatccttgacctttttgatagtaagtcttgcaaagtttagctcgagttttagtaagactaaattcatggaatattcaaaaaaattg |
8110247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University