View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-15 (Length: 77)
Name: Solexa-NF5806-15
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 12401430 - 12401506
Alignment:
| Q |
1 |
agaaggaaaattgccgacgaaatggttgttactgatatcaaactcatgcataagggtgagatttttaaagctctctg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12401430 |
agaaggaaaattgccgacgaaatggttgttactgatatcaaactcatgcataagggtgagatttttaaagctctctg |
12401506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University