View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-17 (Length: 70)
Name: Solexa-NF5806-17
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 1e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 1e-17
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 39322814 - 39322865
Alignment:
| Q |
11 |
caaagacataaaataagttgatcatgcctggtagaatatttctacayttmta |
62 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| || || |
|
|
| T |
39322814 |
caaagacataaaataaattgatcatgcctggtagaatatttctacatttata |
39322865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University