View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-8 (Length: 116)
Name: Solexa-NF5806-8
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold1572 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 21319161 - 21319046
Alignment:
| Q |
1 |
aaggcaggcatttgggttcaagcaccattgggctatgtgattcgagaaatagatgagacaccgtttcttctcctccacaatctccaacacagctaagcat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21319161 |
aagggaggcatttgggttcaagcaccattgggctatgtgattcaagaaatagatgagacaccgtttcttctcctccacaatttccaacacagctaagcat |
21319062 |
T |
|
| Q |
101 |
cacttcactactcact |
116 |
Q |
| |
|
| |||||||| ||||| |
|
|
| T |
21319061 |
cccttcactaatcact |
21319046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1572 (Bit Score: 60; Significance: 4e-26; HSPs: 1)
Name: scaffold1572
Description:
Target: scaffold1572; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 1060 - 1175
Alignment:
| Q |
1 |
aaggcaggcatttgggttcaagcaccattgggctatgtgattcgagaaatagatgagacaccgtttcttctcctccacaatctccaacacagctaagcat |
100 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||| ||||| | || | |||| ||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
1060 |
aaggcaagcacttgggtttaagcaccattgggttatgtaactcaaaaaattgatgagacaccgttttttctcctccacaatctccaacacagttaagcat |
1159 |
T |
|
| Q |
101 |
cacttcactactcact |
116 |
Q |
| |
|
| ||| |||| ||||| |
|
|
| T |
1160 |
ctcttgactaatcact |
1175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University