View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5806-9 (Length: 114)
Name: Solexa-NF5806-9
Description: NF5806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5806-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 68 - 110
Target Start/End: Original strand, 3960562 - 3960604
Alignment:
| Q |
68 |
ggaaaaaacgcgctcagctctgcgcaaactaagacagcagcaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3960562 |
ggaaaaaacgcgctcagctctgcgcaaactaagacagcagcaa |
3960604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University