View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-15 (Length: 135)
Name: Solexa-NF5808-15
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 7 - 113
Target Start/End: Original strand, 485144 - 485249
Alignment:
| Q |
7 |
agacattttatctttgtccatgatcacaatttcacattgatcaccttttctgccaaaaagcaaaacagtttacatttagagcagataataaagtcaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
485144 |
agacattttatctttgtccatgatcacaatttcacattgatcaccttttctgccaaaaagcaaaacag-ttacatttagagcagataataaagtcaaaca |
485242 |
T |
 |
| Q |
107 |
tatatat |
113 |
Q |
| |
|
||||||| |
|
|
| T |
485243 |
tatatat |
485249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University