View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5808-20 (Length: 128)

Name: Solexa-NF5808-20
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5808-20
Solexa-NF5808-20
[»] chr2 (2 HSPs)
chr2 (8-128)||(9524434-9524554)
chr2 (41-86)||(9497428-9497473)
[»] chr7 (1 HSPs)
chr7 (38-83)||(23044752-23044797)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 9524554 - 9524434
Alignment:
8 aaaaggactagggatgaatacagaatgtaatgtaatgtcaattgggatttacgggcaaatataaaatgcacaccttccagcaaactagcttttccccgac 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||    
9524554 aaaaggactagggatgaatacagaatgtaatgtaatgtcaattgggatttacgagcaaatataaaatgcacaccttcccgcaaactagcttttccccgac 9524455  T
108 ctttattggatgcctttttgt 128  Q
    |||||||||||||||||||||    
9524454 ctttattggatgcctttttgt 9524434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 9497473 - 9497428
Alignment:
41 aatgtcaattgggatttacgggcaaatataaaatgcacaccttcca 86  Q
    |||||||||||||||||| |  ||||||||||||||||||||||||    
9497473 aatgtcaattgggatttatgaccaaatataaaatgcacaccttcca 9497428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 38 - 83
Target Start/End: Original strand, 23044752 - 23044797
Alignment:
38 tgtaatgtcaattgggatttacgggcaaatataaaatgcacacctt 83  Q
    ||||||||||||||||||||| |  ||||||| |||||||||||||    
23044752 tgtaatgtcaattgggatttaggatcaaatattaaatgcacacctt 23044797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University