View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-20 (Length: 128)
Name: Solexa-NF5808-20
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-20 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 9524554 - 9524434
Alignment:
| Q |
8 |
aaaaggactagggatgaatacagaatgtaatgtaatgtcaattgggatttacgggcaaatataaaatgcacaccttccagcaaactagcttttccccgac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9524554 |
aaaaggactagggatgaatacagaatgtaatgtaatgtcaattgggatttacgagcaaatataaaatgcacaccttcccgcaaactagcttttccccgac |
9524455 |
T |
|
| Q |
108 |
ctttattggatgcctttttgt |
128 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9524454 |
ctttattggatgcctttttgt |
9524434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 41 - 86
Target Start/End: Complemental strand, 9497473 - 9497428
Alignment:
| Q |
41 |
aatgtcaattgggatttacgggcaaatataaaatgcacaccttcca |
86 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
9497473 |
aatgtcaattgggatttatgaccaaatataaaatgcacaccttcca |
9497428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 38 - 83
Target Start/End: Original strand, 23044752 - 23044797
Alignment:
| Q |
38 |
tgtaatgtcaattgggatttacgggcaaatataaaatgcacacctt |
83 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
23044752 |
tgtaatgtcaattgggatttaggatcaaatattaaatgcacacctt |
23044797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University