View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-27 (Length: 125)
Name: Solexa-NF5808-27
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 1e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 37084303 - 37084244
Alignment:
| Q |
1 |
gaagcggcaccggcgcaacatcgtaaggaagccaattccgggcaggttcgtcgatgacgg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37084303 |
gaagcggcaccggcgcaacatcgtaaggaagccaattccgggcaggttcgttgatgacgg |
37084244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University