View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-29 (Length: 123)
Name: Solexa-NF5808-29
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 4e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 4e-42
Query Start/End: Original strand, 6 - 108
Target Start/End: Original strand, 33248656 - 33248758
Alignment:
| Q |
6 |
gatttttaaaaatttgttgggttggagtgaatgatgattattgacatttaattaaaaatgaagtgaatatgcaatgtgtatgtgagagagtcatttaagc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
33248656 |
gatttttaaaaatttgttgggttggagtgaatgatgattattgacatttaattaaaaatgaagtgaatatgcgatgtgtatgtgggagagtcgcttaagc |
33248755 |
T |
|
| Q |
106 |
gag |
108 |
Q |
| |
|
||| |
|
|
| T |
33248756 |
gag |
33248758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University