View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-30 (Length: 116)
Name: Solexa-NF5808-30
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-30 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 37627221 - 37627106
Alignment:
| Q |
1 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37627221 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
37627122 |
T |
|
| Q |
101 |
tggttctggaaatatc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37627121 |
tggttctggaaatatc |
37627106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 37618807 - 37618692
Alignment:
| Q |
1 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
100 |
Q |
| |
|
||||||| || |||||||| |||||| |||||||||| ||||| || || |||||| || ||||||||||||||||| || || |||||||||| ||| |
|
|
| T |
37618807 |
gaacaagttcatctaatgttccataagtgtcaaagatatcatccattactagcaaaatacatatggtttttgtaagttctatgcggcaatttgaatgaca |
37618708 |
T |
|
| Q |
101 |
tggttctggaaatatc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37618707 |
tggttctggaaatatc |
37618692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University