View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-32 (Length: 111)
Name: Solexa-NF5808-32
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 4e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 47193277 - 47193387
Alignment:
| Q |
1 |
gagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttacatgcttaaatgaagctcatcagggagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47193277 |
gagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagggagaag |
47193376 |
T |
|
| Q |
101 |
ctgaatttcta |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
47193377 |
ctgaatttcta |
47193387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 30 - 111
Target Start/End: Original strand, 9792406 - 9792487
Alignment:
| Q |
30 |
ttacaaaggtacactcgatgatgatcgtgttgctgctgttacatgcttaaatgaagctcatcagggagaagctgaatttcta |
111 |
Q |
| |
|
|||||||| ||||||| | ||| |||||||||||||||||| ||||||||||||||||||||| | ||||||| |||||||| |
|
|
| T |
9792406 |
ttacaaagttacactcaacgattatcgtgttgctgctgttaaatgcttaaatgaagctcatcaagaagaagctaaatttcta |
9792487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University