View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-42 (Length: 50)
Name: Solexa-NF5808-42
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-42 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 5e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-17
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 14571228 - 14571271
Alignment:
| Q |
7 |
attatgggcataatttgtactttatagaaaagttcaaggagatc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14571228 |
attatgggcataatttgtactttatagaaaagttcaaggagatc |
14571271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 19783215 - 19783258
Alignment:
| Q |
7 |
attatgggcataatttgtactttatagaaaagttcaaggagatc |
50 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19783215 |
attatggccataatttatactttatagaaaagttcaaggagatc |
19783258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University