View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5808-7 (Length: 145)
Name: Solexa-NF5808-7
Description: NF5808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5808-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 9e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 9e-22
Query Start/End: Original strand, 52 - 104
Target Start/End: Original strand, 44095310 - 44095362
Alignment:
| Q |
52 |
ttgtaactaagcatgacgatgggacataaagcttagatgttcattcacatgac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44095310 |
ttgtaactaagcatgacgatgggacataaagcttagatgttcattcacatgac |
44095362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University