View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-1 (Length: 280)
Name: Solexa-NF5809-1
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 41921375 - 41921273
Alignment:
| Q |
7 |
acttacactgtgcgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagattgtgaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41921375 |
acttacactgtgcgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagattgtgaag |
41921276 |
T |
|
| Q |
107 |
cat |
109 |
Q |
| |
|
||| |
|
|
| T |
41921275 |
cat |
41921273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 231 - 280
Target Start/End: Original strand, 21358519 - 21358568
Alignment:
| Q |
231 |
cccgattcacctccatcggaatcattaacattctgaacaagagcttgctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21358519 |
cccgattcacctccatcggaatcattaacattctgaacaagagcttgctt |
21358568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 107 - 167
Target Start/End: Complemental strand, 41921239 - 41921182
Alignment:
| Q |
107 |
catacattggcaggcatgatgatgatgattcttgactactgaggttaaatgttggaatatc |
167 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41921239 |
catacattggcagacatgatga---tgattcttgactactgatgttaaatgttggaatatc |
41921182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 1695450 - 1695370
Alignment:
| Q |
19 |
cgctcagttttcaagcgactagcatttttcatttttgataaatgactgtttgtagcatttggatgaaatgcaactaaagat |
99 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| || || |||||||||||||||| ||||||||||||||| |
|
|
| T |
1695450 |
cgctcagttttcaggcggctagcatttttcatttttgataaacgattgattgtagcatttggatgtaatgcaactaaagat |
1695370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University