View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-10 (Length: 140)
Name: Solexa-NF5809-10
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 40 - 140
Target Start/End: Original strand, 31707863 - 31707963
Alignment:
| Q |
40 |
tgggtgtcaagccaaataaatttaccttggcaactgctctaaatgcttgtgcctgtttagcttcaatggaggaagggaaacaatttcatgggttgaggat |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31707863 |
tgggcgtcaagccaaataaatttaccttggcaactgctctaaatgcttgtgcctgtttagcttcaatggaggaagggaaacaatttcatgggttgaggat |
31707962 |
T |
|
| Q |
140 |
c |
140 |
Q |
| |
|
| |
|
|
| T |
31707963 |
c |
31707963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University