View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-11 (Length: 140)
Name: Solexa-NF5809-11
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 13 - 140
Target Start/End: Original strand, 45883907 - 45884049
Alignment:
| Q |
13 |
ggatgagagagaaaggagcggtggagttgggattgaaatgtatgattagtaagtggaggtgagatagtgtggtagatgatgtaacgga------------ |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45883907 |
ggatgagagagaaaggagcggtggagttgagattgaaaggtatgattagtaagtggaggtgagatagtgtggtagatgatgtaacggaagcggtggattg |
45884006 |
T |
 |
| Q |
101 |
---agcgtgtgagtgacatatttccgtcgcaactgaaaactgg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45884007 |
cggagcgtgtgagtgacatatttccgtcgcaactgaaaactgg |
45884049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University