View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-13 (Length: 131)
Name: Solexa-NF5809-13
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 7723848 - 7723728
Alignment:
| Q |
8 |
tgtacgtaccatgagttgttgttgttgt---gatggtggtggtggttatacatcgaagctgactccattacgccaatagatggcgctgtcgctgtgccgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7723848 |
tgtacgtaccatgagttgttgttgttgttgtgatggtggtggtggttatacatcgaagctgactccattacgccaatagatggcgctgtcgctgtgccag |
7723749 |
T |
 |
| Q |
105 |
cggcagaagttgctcttctct |
125 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7723748 |
cggcagaagttgctcttctct |
7723728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University