View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5809-17 (Length: 127)
Name: Solexa-NF5809-17
Description: NF5809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5809-17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 3e-61; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 13448071 - 13447953
Alignment:
| Q |
8 |
gagagacctcaagctggatgattaattcaaatgagtattgtctaaattttttcaacttttcctaataacatcgtggtttcgtcaagcggaagtgtgaatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13448071 |
gagagacctcaagctggatgattaattcaaatgagtattgtctaaattttttcaacttttcctaataacatcgtggtttcgtcaagcggaagtgtgaatg |
13447972 |
T |
|
| Q |
108 |
ttttggattttttctatga |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13447971 |
ttttggattttttctatga |
13447953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 13454560 - 13454468
Alignment:
| Q |
8 |
gagagacctcaagctggatgattaattcaaatgagtattgtctaaattttttcaacttttcctaataacatcgtggtttcgtcaagcggaagt |
100 |
Q |
| |
|
|||| ||||||||| | |||||||||||||| ||| ||||| ||| |||||||||||||| |||||||||| || |||||||||||| ||||| |
|
|
| T |
13454560 |
gagaaacctcaagccgcatgattaattcaaaggagcattgtgtaagttttttcaactttttctaataacattgttgtttcgtcaagcagaagt |
13454468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 13439926 - 13439829
Alignment:
| Q |
8 |
gagagacctcaagctggatgattaattcaaatgagtattgtctaaattttttcaacttttcctaataacatcgtggtttcgtcaagcggaagtgtgaa |
105 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || ||||||||| |||||||||| | ||||||||| || || | |||||||||| |||||||||| |
|
|
| T |
13439926 |
gagagaccccaagcgacatgattaattcaaaggactattgtctatgttttttcaacctatcctaataatattgttggttcgtcaagcagaagtgtgaa |
13439829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University